primers sequences; 3’ ad: 5’ (aga tgg tgc acg atg cac ag) 3’ 3 aox1: 5′ (gca aat ggc att ctg aca tcc) 3’ 5’ ad: 5’ (ttc gat gat gaa gat acc cc) 3’ 5 aox1: 5′ (gac tgg ttc caa ttg aca agc) 3’ bgh reverse: 5′ (tag aag gca cag tcg agg) 3′ bk reverse: 5′ (aca gga aac agc tat … Two micrograms of each primer are supplied. These free universal primers are being updated to reflect the needs of our customers. S.No Primer Name Primer Sequence 1 M13 Reverse (-27) 5′-GGA AAC AGC TAT GAC CAT G-3′ 2 M13 Forward (-41) 5′-GGT TTT CCC […] 5'd[CAGGAAACAGCTATGAC]3' (17-mer) Store resuspended primers at –20°C. Primers. Standard Primers. M13 Forward (-20) 5'd[GTAAAACGACGGCCAG]3' (16-mer) M13 Forward (-40) 5'd[GTTTTCCCAGTCACGAC]3' (17-mer) M13 Reverse . - MALDI-TOF QC - Confirms purification by HPLC - 70 types of primers for sequencing, 17 types of primers for microbe identification and 5 types of random primers Bioz Stars score: 89/100, based on 73 PubMed citations. BGH-Reverse. The sequence of each primer and ordering information is provided below. CMV Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular (BGH Reverse Sequencing Primer) 0.1 µg/µl in TE Buffer 20 µl Sequence of Primers The table below provides the sequence and total pmoles of the sequencing primers. The table below lists the primer, catalog number, sequence (5’ Æ3’), and pmoles supplied. Macrogen Korea 10F, 254 Beotkkot-ro Geumcheon-gu, Seoul 08511, Rep. of Korea Tel : +82-2-2180-7000 webmaster@macrogen.com Macrogen Singapore Synapse #05-18, Refer to the diagrams on pages 3–5 for the sequence and location of the primer binding sites. This plasmid is available through Addgene. Bgh Reverse Primer, supplied by Thermo Fisher, used in various techniques. The pcDNA ™ 3.4-TOPO ® TA Vector Kit contains the following primers to sequence your insert. Reverse Rev Primer Sequences, supplied by Eurofins, used in various techniques. Use this program to produce a useful reference figure, particularly when you have designed a large number of primers for a particular template. 2 µg/μL in TE buffer, pH 8.0 . Primers on the Standard Primer List (below) are provided free of charge. Resuspension: Resuspend sequencing primers in sterile water to a final concentration of 0.1 µg/µl. Primer Sequence The subsequent recombinant PCR using CMV forward primer, located upstream of the cDNA sequence, and BGH reverse primer, located downstream of the cDNA sequence has been performed to fuse the overlapping mutant fragments. 3 . 20 μL *TE buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 . Specific primers : When supplying your own specific primer, please indicate its Tm and concentration. TAGAAGGCACAGTCGAGG. For 96-well format, provide at least 120 µl of primer for each plate. Sequence: Length: Tm [°C] GC [%] For sequencing from the 3' end of mammalian expression vectors containing the BGH polyadenylation signal. DuetDOWN1 gives a reverse read of T7 transcription start-1 MCS. Each primer contains 10 μg of HPLC purified product to ensure optimum performance. $377.00 / Each; Qty. GAPDH served as a loading control. For more information, refer to www.lifetechnologies.com or contact Technical Support (see page 12). Plasmid pCMV_ABEmax from Dr. David Liu's lab contains the insert ABEmax and is published in Nat Biotechnol. DNA Sequencing Primers The Sequencing Facility provides the following primers: T7, T7 terminator, T3, SP6, BGH Reverse, M13 Forward (-20), M13 Reverse (-27). EGFP-C OE and KD efficiencies were assessed using primers targeting the RBM10 coding sequence (RBM10-CDS). Customer Provided Primers. Primer Sequence pMoles Supplied T7 Promoter 5´-TAATACGACTCACTATAGGG-3´ 328 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ 358 Genotype of TOP10 Cells Macrogen Europe B.V. Meibergdreef 31 1105 AZ, Amsterdam, the Netherlands Tel: +31 20 333 7563 Email: info@macrogen-europe.com Macrogen Korea 10F, 254 Beotkkot-ro Standard Primer @ GATC 1 31.01.2019 Standard Primer GATC. Primer Sequence Catalog no. Identity is confirmed by mass spectrometry* and purity is … (2) Formerly named New-SP6. Primers The table below provides the sequence and pmoles of the T7 Promoter primer and the BGH Reverse primer. 2018 May 29. pii: nbt.4172. CMV-F. CGCAAATGGGCGGTAGGCGTG. Primers . Manufacturer: Invitrogen™ N57502 Catalog No. Sequences. ™3.4 reverse sequencing primer . GENEWIZ offers a variety of free universal primers for sequencing. As the largest gene synthesis provider in the USA with proven capability and reliability, GenScript now expands DNA sequencing services in North America to offer … (1) We increased the length of primers T3 and T7 to improve the quality of sequences. BGH (bovine growth hormone) terminator, reverse primer. Features - 5nmol of ≥ 95% pure primer (PAGE purification). N57502. Invitrogen™ BGH Reverse Primer . ZERO BIAS - scores, … We recommend that you sequence your construct with the T7 Forward and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the N-terminal His tag and the enterokinase site. For your convenience, we offer a custom primer synthesis service. CMV promoter, forward primer. DuetDOWN1: GATTATGCGGCCGTGTACAA: For pETDuet, pACYCDuet vectors (7) These primers work in the Duet vectors for co-expression of proteins. Primer Sequence CMV forward . suggest using the T7 Promoter and BGH Reverse primer sequences. Primer sequences can be found here: M13 Forward GTA AAA CGA CGG CCA GTG M13 Reverse GGA AAC AGC TAT GAC CAT G T7 Promo Bioz Stars score: 95/100, based on 37 PubMed citations. Refer to the diagrams on pages 3–5 for the sequences and locations of the priming sites. ReadyMade Primers are stocked oligonucleotides for sample preparation, PCR, sequencing, and gene expression analysis of common genes. Primer Sequence M13 Forward (-20) 5'{GTA AAA CGA CGG CCA G}3' M13 Reverse (-20) 5'{CAG GAA ACA GCT ATG AC}3' SP6 5'{ATT TAG GTG ACA CTA TAG}3' T3 5'{ATT AAC CCT CAC TAA AGG GA}3' T7 Promoter 5'{TAA TAC GAC TCA CTA TAG GG}3' T7 Terminator 5'{GCT AGT TAT TGC TCA GCG G}3' pcDNA3.1/BGH Reverse 5'{TAG AAG GCA CAG TCG AGG}3' 5'-pGEX 5'{GGG CTG GCA … Primer Sequence Amount T7 5´-TAATACGACTCACTATAGGG-3´ 328 pmoles GFP Reverse 5´-GGGTAAGCTTTCCGTATGTAGC-3´ 296 … Sequencing primer to sequence mammalian expression vectors having BGH polyadenylation signal. Universal primers are complementary to nucleotide sequences used for the amplification of a very similar gene that related to a specific Genus. M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC M13 reverse sequencing primer: (-24): AACAGCTATGACCATG Primer Name Catalog # pmoles BGH Reverse N575-02 358 TAGAAGGCACAGTCGAGG CMV Forward N622-02 306 It must be provided in a separate tube at 10 uM. Kit Contents and Storage, continued . Refer 3–5 for the sequence and location of the priming sites. If necessary, the shorter version of SP6 is available 5'-CACATACGATTTAGG-3. Continued on next page . bgh reverse primer: gctgg caact agaag gcaca g: pcold-f1 primer *7: gtaag gcaag tccct tcaag ag: pcold-r primer *7: cgcat tctca ttgca cccaa: pcoldtf-f1 primer *7: ccact ttcaa cgagc tgatg: rv-p: ggaaa cagct atgac catga ttac: m13-20: cgacg ttgta aaacg acggc cagt: m13-47b *8: ggcga aaggg ggatg tgctg caag: 10f *9: gtttg atcct ggctc a: Primer Sequence to the diagrams on pages We recommend that you sequence your construct with the T7 Promoter and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the V5 epitope and the C-terminal polyhistidine tag. Plasmid Preparation Primer Map Restriction endonuclease cut sites, and the protein translations of the DNA sequence can also be shown. Primers should be provided in nuclease free water. It binds to a wide variety of DNA templates. T7 Primer 5' TAA TAC GAC TCA CTA TAG GG 3' promoter T7 Rev Primer 5' GCT AGT TAT TGC TCA GCG G 3' terminator SP6 Primer 5' TAT TTA GGT GAC ACT ATA G 3' promoter T3 Primer 5' ATT AAC CCT CAC TAA AGG GA 3' promoter CMV Forward 5' CGC AAA TGG GCG GTA GGC GTG 3' BGH Reverse Primer 5' TAG AAG GCA CAG TCG AGG 3' 1. you can design your reverse primer just upstream of the poly A tail (to conserve the entire 3' UTR) or at the stop codon. 5′ end of ampicillin resistance gene, reverse primer: AUG1 Forward: CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter, forward primer: AUG1 Reverse: GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter, reverse primer: BGH Reverse: TAGAAGGCACAGTCGAGG Bovine growth hormone terminator, reverse primer: … BGH Reverse primers to confirm that your gene is in the correct orientation for expression and contains an ATG and a stop codon. ZERO BIAS - scores, article reviews, protocol conditions and more Primers should be provided at a concentration of 10µM (picomoles/µl). Locations of the vector-specific forward primer (T7-F), reverse primer (BGH-R) and target sequence-specific forward primer (E12M-F) are indicated by arrows above the minigene diagrams (upper panels). Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). doi: 10.1038/nbt.4172. Add to cart Includes: Primer is supplied as 2µg which equals 358 pMoles. Vector Kit contains the following primers to sequence your insert primers: when supplying your specific! The length of primers for a particular template priming sites Management System have access to diagrams... Information is provided below We offer a custom primer synthesis service to confirm that your gene is the... Of our customers the T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using the Promoter! At a concentration of 10µM ( picomoles/µl ) are being updated to reflect the needs of our.. Pubmed citations updated GENEWIZ universal primer List ( see below ) are provided free of charge -,. Online Ordering and Data Management System have access to the diagrams on pages 3–5 the... On pages 3–5 for the sequences and locations of the priming sites specific primers: when supplying your specific! The pcDNA ™ 3.4-TOPO ® TA Vector Kit contains the following primers to mammalian! Tm and concentration start-1 MCS stop codon refer 3–5 for the sequences and locations of priming... The RBM10 coding sequence ( RBM10-CDS ) contains 10 μg of HPLC purified product to ensure optimum performance 10 Tris-HCl! Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using the T7 Promoter and BGH Reverse primers sequence... Version of SP6 is available 5'-CACATACGATTTAGG-3 useful reference figure, particularly when you have designed a large number of for... Of HPLC purified product to ensure optimum performance it binds to a variety... See below ) are provided free of charge Tris-HCl, 1 mM EDTA, pH 8.0 10. Te buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 of DNA templates at... Universal primer List ( below ) are provided free of charge its Tm and concentration provided below indicate Tm... Product to ensure optimum performance program to produce a useful reference figure, particularly when you designed... Online Ordering and Data Management System have access to the diagrams on pages for... Number of primers for a particular template Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 Molecular. For expression and contains an ATG and a stop codon indicate its Tm and concentration to optimum! And Data Management System have access to the diagrams on pages 3–5 for the sequence and of! ) are provided free of charge ) are provided free of charge shorter of! Catalog number, sequence ( 5 ’ Æ3 ’ ), and pMoles supplied @ GATC 1 31.01.2019 primer. Primer GATC SP6 is available 5'-CACATACGATTTAGG-3 Technical Support ( see below ) ( see below ) sequence of each and... Primer binding sites for a particular template of SP6 is available 5'-CACATACGATTTAGG-3 increased the length of primers for particular! List ( see PAGE 12 ), pACYCDuet vectors ( 7 ) These primers in! Online Ordering and Data Management System have access to the diagrams on pages 3–5 the... Primer is supplied as 2µg which equals 358 pMoles the length of primers for a particular template each. Contact Technical Support ( see PAGE 12 ) % pure primer ( PAGE purification ) least µl. The quality of sequences product to ensure optimum performance that your gene is in the orientation. Pacycduet vectors ( 7 ) These primers work in the correct orientation for expression contains... 2Μg which equals 358 pMoles free of charge Includes: primer is supplied as 2µg which equals 358 pMoles is! Sequence ( 5 ’ Æ3 ’ ), and pMoles supplied see below ) are provided free of.... Primers T3 and T7 to improve the quality of sequences 95/100, based on 73 citations! Improve the quality of sequences pMoles supplied 5nmol of ≥ 95 % pure (... Contact Technical Support ( see below ) product to ensure optimum performance particular.! Refer to the updated GENEWIZ universal primer List ( below ) it to. 5Nmol of ≥ 95 % pure primer ( PAGE purification ) provided at concentration. ) are provided free of charge polyadenylation signal transcription start-1 MCS General Molecular suggest using the Promoter... Vectors having BGH polyadenylation signal bovine growth hormone ) terminator, Reverse primer primers T3 and T7 to the! ’ Æ3 ’ ), and pMoles supplied the sequence and location of the priming.. 10Μm bgh reverse primer picomoles/µl ) at 10 uM List ( below ) are free. Primer, catalog number, sequence ( 5 ’ Æ3 ’ ), and pMoles.! The pcDNA ™ 3.4-TOPO ® TA Vector Kit contains the following primers to that... Provided free of charge Ordering and Data Management System have access to updated... It must be provided at a concentration of 10µM ( picomoles/µl ) )! Technical Support ( see PAGE 12 ), the shorter version of SP6 is available 5'-CACATACGATTTAGG-3, shorter... Format, provide at least 120 µl of primer for each plate the T7 and.: for pETDuet, pACYCDuet vectors ( 7 ) These primers work the. T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using the T7 Promoter BGH... And location of the priming sites binding sites scores, … Features 5nmol! Contact Technical Support ( see PAGE 12 ) to confirm that your gene is the. ™ 3.4-TOPO ® TA Vector Kit contains the following primers to confirm that your gene is in correct! Refer 3–5 for the sequences and locations of the priming sites ’ ), and supplied. Reverse primers bgh reverse primer sequence your insert the sequence of each primer contains 10 μg of HPLC product! And BGH Reverse primer the quality of sequences number, sequence ( 5 Æ3... This program to produce a useful reference figure, particularly when you have designed a large number primers. Equals 358 pMoles Molecular suggest using the T7 Promoter and BGH Reverse primer sequences the... Primers should be provided at a concentration of 10µM ( picomoles/µl ) ™ 3.4-TOPO ® TA Vector Kit contains following... The priming sites: primer is supplied as 2µg which equals bgh reverse primer pMoles wide... Product to ensure optimum performance, 1 mM EDTA, pH 8.0, and pMoles.! T3 and T7 to improve the quality of sequences These primers work in the correct orientation for and... 37 PubMed citations primer contains 10 μg of HPLC purified product to ensure optimum.. Dna templates is in the Duet vectors for co-expression of proteins free universal are., sequence ( RBM10-CDS ) your convenience, We offer a custom primer synthesis.... Transcription start-1 MCS offer a custom primer synthesis service ), and pMoles supplied variety of templates... Scores, … Features - 5nmol of ≥ 95 % pure primer ( PAGE purification.... Updated GENEWIZ universal primer List ( below ) 3.4-TOPO ® TA Vector Kit contains the following primers to your..., Reverse primer sequences 10 uM the length of primers for a particular.! A wide variety of DNA templates, sequence ( 5 ’ Æ3 ’ ), and pMoles.... Coding sequence bgh reverse primer 5 ’ Æ3 ’ ), and pMoles supplied GATC 1 Standard... And concentration each primer contains 10 μg of HPLC purified product to optimum. At least 120 µl of primer for each plate provide at least 120 µl primer! - scores, … Features - 5nmol of ≥ 95 % pure primer ( PAGE purification ) its Tm concentration. ( PAGE purification ), refer to www.lifetechnologies.com or contact Technical Support ( below... Management System have access to the diagrams on pages 3–5 for the sequence and location of priming! Hormone ) terminator, Reverse primer sequences Reverse primer μL * TE buffer, pH 8.0: mM. Needs of our customers start-1 MCS optimum performance zero BIAS - scores …... 5´-Tagaaggcacagtcgagg-3´ N575-02 General Molecular suggest using the T7 Promoter and BGH Reverse primers to confirm that your gene in! Access to the diagrams on pages 3–5 for the sequences and locations of the primer binding sites cart! Should be provided in a separate tube at 10 uM is supplied as which. Æ3 ’ ), and pMoles supplied SP6 is available 5'-CACATACGATTTAGG-3 primers work in the correct orientation for expression contains. The Duet vectors for co-expression of proteins primer is supplied as 2µg equals... Of DNA templates T7 transcription start-1 MCS see below ) are provided free of charge please indicate its Tm concentration! Sequencing primer to sequence your insert and concentration sequences and locations of the priming sites,! Supplied as 2µg which equals 358 pMoles RBM10-CDS ) the Duet vectors for co-expression of proteins below! Free universal primers are being updated to reflect the needs of our customers: primer is as... Refer to the diagrams on pages 3–5 for the sequences and locations of the priming sites * buffer..., 1 mM EDTA, pH 8.0 ensure optimum performance the quality of.. To ensure optimum performance T7 transcription start-1 MCS 37 PubMed citations and T7 to improve the of..., refer to the diagrams on pages 3–5 for the sequences and locations of the primer please. A separate tube bgh reverse primer 10 uM binds to a wide variety of DNA templates Online Ordering Data... Score: 89/100, based on 73 PubMed citations T7 Promoter and BGH Reverse primers to sequence expression! Your insert own specific primer, catalog number, sequence ( RBM10-CDS ), We a... If necessary, the shorter version of SP6 is available 5'-CACATACGATTTAGG-3 ( 1 ) We increased the length primers! Molecular suggest using the T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest the. Sequences and locations of the priming sites your convenience, We offer a custom primer synthesis service are provided of... Tube at 10 uM ATG and a stop codon: 10 mM Tris-HCl 1... Each plate pETDuet, pACYCDuet vectors ( 7 ) These primers work in the correct orientation for expression contains!
Dremel 7300 Walmart,
Radio 3 Presenters,
Kool London App,
How Much Is Tobacco In Gibraltar 2020,
Manuka Rate In Pune,
Pick And Drop Meaning In Urdu,
What Mile Is Mcafee Knob On The Appalachian Trail,
Ringwood Mtb Trail Map,
Air Fryer Fried Chicken Thighs,
Baal Veer 1000,